In a shocking turn of events, 23andMe has filed for bankruptcy. The genetic testing giant, once valued at $6 billion after ...

Almost two decades after it entered the market, commercial genetic testing provider 23andMe filed for bankruptcy earlier this ...

Many people that have written to us or I’ve talked to have used the test as inspiration to make really, really powerful life ...

DNA testing company 23andMe announced that it filed for Chapter 11 bankruptcy on March 23. Customers send vials of their saliva to 23andMe for results on ancestry and health. The company can run ...

Have you ever wondered about your genetic ancestry or familial health risks? Or perhaps needed legal proof of biological ...

Cybernews research indicates significant gaps in cybersecurity practices across the DNA testing industry. Most of the top consumer DNA services score a D or less in cybersecurity.

Applications range from precision medicine and resilient agriculture to biosensors for national security and biobased ...

TAATCAAATTGTACATATGATAGCCGAGAGCAGCGAAGGCTAGAAGAGCAAGAAGTTCATAAGCATAGCGAGGAGTATCTTTTTCATAGTAGCCGATATAGAACATAAGAGGACCAACATAGAAGAAATGGATACTATTTATCCAGATTCCATAAGATCCTGTCAT ...

Sen. Bill Cassidy is probing 23andMe, which recently filed for bankruptcy protection, to ensure the company does not sell ...

Since the COVID-19 pandemic, pretty much everybody is familiar with this technology: paper-based rapid test strips, also ...

With 80% of rare diseases having a genetic cause, getting a head start on genetic testing for infants can be the key to an ...